Incubator

Within the confines of a sterile laboratory, this lie dormant vessels, primed for the infusion of consciousness, offering the attractive prospect of perpetual existence devoid of mortality's grasp. 
------------------------------------------------- 
SUBJECT_7842 
Code: 0X3B7F9D 
Genetic Marker: ZE-12-65 
Neural Signature: NS-17-4E-9P-22 
Blood Type: O+ 
Sequence: GATCAGTCTAGCTAGCTAGCTAGCATCGATCGATCGATCGA 
Subcutaneous Microchip ID: SMID-3456 
Neurological examinations: Primitive reflexes observed; code: NER-456S 
Physiological measurements: Within expected ranges for infancy; code: PME-789K 
Observations during interaction: Responsive to caregiver stimuli; code: OIC-234N 
Parental observations: Regular feeding and sleeping patterns noted; code: POR-567P